Skip to content

RNAFramework Map Specifications

Process Details

  • Name: RNAFramework_Map
  • Process UUID: dc64a984890e4b2d965454eaa002327a
  • Process Group: Misc.

Overview

RNAFramework Map is a comprehensive read mapping process that utilizes the rf-map tool for aligning RNA sequencing reads to reference genomes. This process supports both Bowtie and Bowtie2 aligners and includes integrated adapter trimming capabilities using cutadapt, making it particularly suitable for RNA structure probing and RNA framework analysis workflows.

This process is implemented in Bash, which invokes the RNAFramework rf-map tool for read alignment and preprocessing.

Key Functionality

  • Read Mapping: Aligns RNA-seq reads to reference genomes using either Bowtie or Bowtie2 aligners
  • Adapter Trimming: Automatically trims 5' and 3' adapter sequences using integrated cutadapt functionality
  • Quality Control: Performs quality-based trimming and filtering of reads based on configurable parameters
  • Flexible Alignment: Supports both paired-end and single-end sequencing data with customizable alignment parameters

Input/Output Specification

Inputs

Required Inputs

  • reads

    • Description: RNA sequencing reads in FASTQ format
    • Format: fastq

  • mate

    • Description: Mate pair information specifying whether reads are single-end or paired-end
    • Format: mate

  • bowtieIndex

    • Description: Pre-built Bowtie/Bowtie2 index files for the reference genome
    • Format: bowtieIndex

Outputs

  • bamFile

    • Description: Aligned reads in Binary Alignment Map format containing mapping results
    • Format: bam

  • logFile

    • Description: Process log file containing alignment statistics and runtime information
    • Format: log

Parameters & Settings

These parameters can be adjusted in the Foundry UI when running this process.

  • 5' adapter sequence

    • Description: Sequence of 5' adapter to clip (Default: GTTCAGAGTTCTACAGTCCGACGATC). Sequence of 5' adapter will be automatically reverse-complemented. Multiple adapter sequences can be provided as a comma-separated list.
    • Default value: GTTCAGAGTTCTACAGTCCGACGATC

  • 3' adapter sequence

    • Description: Sequence of 3' adapter to clip (Default: AGATCGGAAGAGCACACGTCT). Multiple adapter sequences can be provided as a comma-separated list.
    • Default value: AGATCGGAAGAGCACACGTCT

  • Aligner settings

    • Description: Choose a mapper. (Default: Bowtie v1)
    • Available options: bowtie (default), bowtie2

  • Seed length

    • Description: Seed length (>=5, Default: 28)
    • Default value: 28

  • Bowtie n mode

    • Description: Uses Bowtie in -n mode (0-3, Default: 2)
    • Default value: 2

  • Bowtie v mode

    • Description: Uses Bowtie in -v mode (0-3, Default: disabled). Leave empty to disable
    • Default value:

  • Max alignment

    • Description: Discards alignment if more than this number of alignments exist (Default: 1)
    • Default value: 1

  • Max RAM

    • Description: Maximum MB of RAM for best-first search frames (Default: 128)
    • Default value: 128

  • Seed length for bowtie2

    • Description: Seed length (3<=l<=32, Default: 22)
    • Default value: 22

  • Seed mismatches

    • Description: Bowtie seed mismatches (0-1 mismatches, Default: 1)
    • Default value: 1

  • Seed extension attempts

    • Description: Maximum number of seed extension attempts (>=0, Default: 15)
    • Default value: 15

  • Re-seeding attempts

    • Description: Maximum number of re-seeding attempts for reads with repetitive seeds (>=0, Default: 2)
    • Default value: 2

  • Max. and min. mismatch pen.

    • Description: Maximum and minimum mismatch penalities (>=0, Default: 6,2). Use a comma (',') to separate Maximum and Minimum mismatch penalties.
    • Default value: 6,2

  • Extra ref. bases

    • Description: Number of extra reference bases included on sides of the DP table (>=0, Default: 15)
    • Default value: 15

  • Read max. & min. gap open penalty

    • Description: Read's gap open and extend penalities (>=0, Default: 5,3). Use a comma (',') to separate Maximum and Minimum mismatch penalties.
    • Default value: 5,3

  • Ref. max. & min. gap open penalty

    • Description: Reference's gap open and extend penalities (>=0, Default: 5,3). Use a comma (',') to separate Maximum and Minimum mismatch penalties.
    • Default value: 5,3

  • Match bonus in local alignment

    • Description: Match bonus in local alignment mode (>=0, Default: 2)
    • Default value: 2

  • Enable local alignment?

    • Description: Enables local alignment mode (Default: entire read must align)
    • Available options: false (default), true

  • Allow paired-end dovetailed reads?

    • Description: Paired-end dovetailed reads are allowed (mates extend past each other)
    • Available options: false (default), true

  • Enter Aligner Parameters?

    • Description: Option to manually specify additional aligner parameters
    • Available options: false (default), true

  • Manual Aligner Parameters

    • Description: Manually specify additional aligner parameters (e.g. '-n 2 -l 15'). For a complete list of aligner's parameters, please check aligner's documentation.
    • Default value:

References & Resources